Class 12

Class 12 Biotechnology Sample Question Paper 2023 Solved

Class 12 Biotechnology Sample Paper 2023

SECTION A

1. Male sterility is widely used in crops such as maize, sunflower for hybrid production. Male sterile plants are created by introducing a gene encoding-

  • (a) Barnase protein
  • (b) TA29
  • (c) Barstar protein
  • (d) Coat protein

2. Body builders prefer to drink buffalo milk to build muscle mass. Determine the reason for this?

  • (a) Easier to digest
  • (b) Lower fat content
  • (c) Higher calcium and phosphorus content
  • (d) Balanced calorie source

3. An industrially important secondary metabolite which is used as a red pigment in lipstics and dye for silk is obtained from-

  • (a) Datura stramonium
  • (b) Lithospermum erythrorhizon
  • (c) Digitalis lanata
  • (d) Coptis japonica

4. Proteome of a given cell is dynamic because :

  • (a) In response to Internal and external changes the biochemical machinery of the cell could be changed.
  • (b) In response to Internal and external changes the biochemical machinery of the cell could not be changed.
  • (c) No direct relationship exists between Internal and external changes in the biochemical machinery of the cell.
  • (d) Indirect relationship exists between Internal and external in changes the biochemical machinery of the cell.

5. Artificial seeds are produced by-

  • (a) Encapsulating somatic embryos in calcium alginate beads
  • (b) Desiccating the somatic embryos with or without coating
  • (c) Hydrating the somatic embryos
  • (d) Hydrating the zygotic embryos.

6. Being a researcher, you want to improve the deficiency of certain amino acids in cereals and legumes. Choose the technique out of the following which will be the best to achieve your goal:

  • (a) Plant tissue culture
  • (b) Adding fertilizers to soil
  • (c) Protein engineering
  • (d) Vegetative Propagation

7. Foreign DNA is directly introduced into the recipient cell using a fine micro-syringe to transform it. The probable advantage this provides could be:

  • a) No specialised equipment required
  • b) No damage to cells
  • c) Low transduction rate
  • d) Precision of delivery

8. A piece of young hypocotyl was cultured in MS medium in a plant tissue culture lab.

This is a type of-

  • (a) Organ culture
  • (b) Callus culture
  • (c) Explant culture
  • (d) Mass cell culture

9. Molecular Biologists prefer to use artificial vectors with MCS. List a benefit for this choice.

  • (a) Flexibility in choice of insert size
  • (b) Flexibility in choice of vector size
  • (c) Flexibility in choice of host organism
  • (d) Flexibility in choice of restriction enzyme

10. Native enzyme Subtilisin is inactivated by bleach, in detergents because of oxidation of methionine at position 222. Choose a strategy that will help overcome this problem:

  • (a) Use Pepsin instead of Subtilisin
  • (b) Eliminate use of bleach
  • (c) Substitute another amino acid at position 222
  • (d) Use Amylase instead of Subtilisin

11. Culture-based approaches for detecting pathogens, as compared to PCR-based assays, are

  • (a) Faster, safer, but less specific
  • (b) Slower but safer and more specific
  • (c) Slower, less safe and less specific
  • (d) Slower, less safe, but more specific

12. A 100 Kb DNA fragment has to be cloned in a host cell. Which vector should be used for this experiment?

  • a) Plasmid
  • b) Cosmid
  • c) BAC
  • d) Bacteriophage lambda

Question No. 13 to 16 consist of two statements – Assertion (A) and Reason (R). Answer these questions selecting the appropriate option given below:

  • A. Both (A) and (R)  are true, and (R)  is the correct explanation of the assertion
  • B. Both (A) and (R)  are true, but (R)  is not the correct explanation of the assertion
  • C. (A) is true, but (R)  is false
  • D. Both (A) and (R)  are false

13. Assertion-The functional property of whey protein exploited in confectionery is browning.

Reason-Whey proteins undergo Maillard reaction, providing colour and aroma to food items.

  • Ans: A. Both (A) and (R)  are true, and (R)  is the correct explanation of the assertion

14. Assertion- Foaming is a problem in most microbiological processes.

Reason- It is caused due to the presence of fatty acids and silicones in the culture medium.

  • Ans: C. (A) is true, but (R)  is false

15. Assertion- Whey, mixed with herbs and honey, is administered to the sick to treat ailments like jaundice and infected skin lesions.

Reason – Whey proteins elevate the levels of glutathione, which protects the cells from harmful oxygen intermediates.

  • Ans: A. Both (A) and (R)  are true, and (R)  is the correct explanation of the assertion

16. Assertion-It’s difficult to count genes even if we know where the genes are in a given genome

Reason- There is no simple correlation between the intuitive complexity of an organism and the number of genes in its genome.

  • Ans: A. Both (A) and (R)  are true, and (R)  is the correct explanation of the assertion

SECTION B

17. Depict the production and mode of action of tissue plasminogen activator through a diagram or flowchart.

Ans: Tissue Plasminogen Activator (tPA)

Diagram /Flow chart ( Either one )

Flow chart

18. X is a valuable tool in plant breeding, wherein variation in tissue culture-regenerated plants from somatic cells can be used for the development of crops with novel traits. Identify X. State any one example where this tool can be used for crop improvement.

Ans: Somaclonal variations. It helps in the production of mutant,s e.g. disease resistance in Potato. 

OR

Leaf explants of brinjal are showing multiple shoot regeneration in a plant tissue culture laboratory. Which plant regeneration pathway is depicted here? In this process, what would happen if either auxins or cytokinins are high in the medium?

Ans: Organogenesis. If auxins are high in the medium, it promotes rooting, while if cytokinins are high, shoot formation is promoted.

19. Given below is a list of the first 06 residues of the beta helix in myogloblin from different organisms. Based on this information, which amino acids (a) are most conserved, and (b) are highly variable.

Ans: G amino acid is most conserved. 

An amino acid is most variable.

20. A doctor has to prescribe a protein rich diet to sportsmen to improve their performance. What are the two parameters that the doctor should consider while prescribing these protein sources. Explain.

Ans: Essential amino acids and BCAA profile: Essential amino acids are those amino acids

which have to be obtained from food and cannot be made in our cells.

The branched chain amino acids (BCAA) are essential for the biosynthesis of muscle proteins. They help in increasing the bioavailability of high complex carbohydrates intake and are absorbed by muscle cells for anabolic muscle building activity.

Biological value (BV) measures the amount of protein nitrogen that is retained by the body from a given amount of protein nitrogen that has been consumed. It has been observed that the BV of whey proteins is the highest compared to rice, wheat, soya and egg proteins.

Protein efficiency ratio (PER)- PER is used as a measure of growth expressed in terms of weight gain of an adult by consuming 1g of food protein. The PER value of the following proteins are arranged in decreasing order- whey, milk, casein, soya, rice, wheat.

21. (a) Identify the technique shown below.

(b) State any three applications of the technique.

Ans: a) Production of MoAb.

b) This technology has revolutionised the area of diagnostics and antibody-based therapies.

1) The availability of monoclonal antibodies has helped in the early detection of many infectious diseases like hepatitis and AIDS.

2) Therapeutic mAb –

OKT3 Therapeutic mAb – Herceptin OKT-3 is a monab-CD3, an immunosuppressant drug given intravenously to reverse the acute rejection of transplanted organs such as the heart, kidney and liver.

Herceptin (trastuzumab) is a monoclonal antibody approved for the therapy of early-stage breast cancer that is Human Epidermal Growth Factor Receptor 2-positive (HER2+). 

SECTION C

22. (a) Chymotrypsinogen is inactive form of enzyme chymotrypsin. Which molecular alteration converts it into active form?

(b)The catalytic triad in chymotrypsin leads to a charge relay system. Justify.

Ans: (a) In chymotrypsinogen, the substrate binding site is blocked and hence the enzyme is inactive. In-situ activation of trypsin involves a proteolytic cut in chymotrypsinogen, which results in a conformational change, exposing the substrate binding pocket.

(b) Asp 102, His 57 and Ser 195 lie in this orde,r forming a charge relay; The negatively charged aspartate carboxylate residue pulls the Ser–OH proton through His, leaving it with a negative charge, Ser195 becomes acidic due to the unique constellation of three amino acid residues because the protein has folded uniquely in space

OR

Haemoglobin protein of a normal individual has to be compared with that of a person with sickle cell anaemia in a pathology laboratory. Represent the steps of the technique, which can be used for the same, in the form of a flow chart.

Ans

23. Given below are few transgenic crops approved by US Food and Drug Administration along with the improved character. Name the genes A to F introduced for the improved character.

Ans

24. In animal cell culture, osmolarity of the culture medium has significant role in cell growth and function. Justify. Which ingredients decides osmolarity of the medium.

Ans: Membrane integrity is maintained. It helps to maintain the shape and size of cells.

Salt, glucose and amino acids (any two) are the major ingredients that determine the osmolality of the medium.

25. You have the gene sequence of a protein which has a proteolytic activity. How will you establish through tools of bioinformatics that this protein:

(a) Has homologues in other organisms

(b) Belongs to the chymotrypsin family

(c) Has a database that can we used to trace the evolutionary history of this proteolytic protein.

Ans

  • (a) →BLAST search→ Find out→ homologous sequences in other organisms by looking for the gene sequence of the given proteolytic enzyme.
  • (b) Look for conserved domains and find whetherit  belongs to the domain of Chymotrypsin or to another family of proteins
  • (c) The ALI database can be used for Phylogenetic (Evolutionary) analysis and alignment of proteins.

26. What are type II restriction endonucleases (RE)? Give an example of a type II RE that generates flush ends and the sequence recognized by it. Mention two other enzymes and their utility in cloning experiment.

Ans: R.E. type II recognizes a specific DNA sequence and cut within the sequence generating sticky/flush ends. In recombinant DNA technology, we use type II RE as they are highly specific in their action.

Alu I with the restriction site (One strand) 5‟ AGCT‟3 and Sma 1 with the restriction site 5 „CCC GGG‟ 3 (flush ends) (One strand)

The functions of a) Alkaline phosphatase b) DNA ligase.

  • *The role of alkaline phosphatase is to prevent self re-ligation of the vector
  • *The role of DNA ligase is to make 3‟-5‟ phosphodiester bond.

27. Bioinformatics databases provide resources for gene level sequences such as RefSeq, Homologene , Paralogs and UniGene and BLAST . Which of these would you use as most suitable starting point for :

  • i) Avoiding redundancy in EST data.
  • ii) For inferring relations among organisms.
  • iii) Information retrieved from this resource will be used in designing gene chips.

Ans: i) UniGene database

ii) Homologene database

iii. RefSeq database

28. a) Identify the vector shown below :

b) How can we use LEU2 gene as a selectable marker?

Ans: a) p BR 322

b) The LEU2 gene codes for an enzyme required for the synthesis of the amino acid leucine.  Yeast cells having this plasmid can grow on a medium lacking leucine and hence can be selected e.g. Yep

SECTION D

29. Mass Spectrometry

Mass spectrometry (MS) has emerged as an important tool in biotechnology. It is extremely useful in obtaining protein structural information such as peptide mass or amino acid sequences. The molecular ions are generated either by a loss or gain of a charge (e.g. electron ejection, protonation or deprotonation). After the ions are formed, they can be separated according to their m/z ratio and finally detected. A protein with a molecular weight of 10,000 dalton generates five different peaks with the ions containing 5, 4, 3, 2, and 1 charges, respectively, as shown below.

(a)What happens if there is a loss of charge from a biomolecule?

(b)Mass spectrometry is an analytical tool. Justify the statement.

(c) Calculate the m/z ratio each for protein ions containing 5, 4, 3 and 2 charges.

OR

(c) A protein has a molecular weight of 20,000 daltons and it forms two protein ions containing 6 and 7 charges. What will be it‟s mass/charge ratio?

Ans: (a) The molecular ions are generated either by a loss or gain of a charge (e.g. electron ejection, protonation or deprotonation)

(b) Mass spectrometry is used in

  • (i) Obtaining protein structural information such as peptide mass or amino acid sequence
  • (ii) Identifying the type and location of amino acid modification within proteins.

(c) (c)m/z= (M+ nH)n+/ n+

For n=5, m/z= 10,000+ 5/5= 2001

For n=4,m/z= 10,000+ 4/4= 2501

For n=3, m/z= 10,000+ 3/3= 3334.3

For n=2, m/z= 10,000+ 2/2=5001

OR

(c) m/z= (M+ nH)n+/ n+

For n=6, m/z= 20,000+ 6/6= 3334.33

For n=7, m/z= 20,000+7/7=2858.14

30. Growth kinetics is an autocatalytic reaction which implies that the rate of growth is directly proportional to the concentration of cell. As the cell divides, we shall have

Doubling time, which is the time taken by the population to double through one round of cell division, is inversely related to specific growth rate.

  • (a) In a microbiology laboratory, one bacterial culture is marked “X” with a generation time of 20 s and other bacterial culture is marked “Y” with a generation time of 30 s. Which bacterial culture will proliferate rapidly?
  • (b) Using the above table, calculate the number of divisions the population must have undergone to increase from 104 to 107 in 24 hours.
  • (c) Using the above table, calculate the generation time (doubling time) of a bacterial population in which the number of bacteria increases from 108 cells/ml to 1014 cells/ml during four hours of exponential growth.

OR

(c) Explain any two different ways to measure microbial growth.

Ans: a) As generation time is inversely related to specific growth rate, hence bacterial culture marked “X” with generation time 20s will proliferate rapidly.

b) n = 3.3 (Log 107– Log 104)

= 3.3 ( 7 – 4 )

= 10

c) First, calculate the number of divisions the population must have undergone to increase from 108 to 1014 in 4 hours.

n = 3.3 (Log 1014– Log 108)

= 3.3 (6 )

= 19.8

td = 240 minutes / 20

= 12 minutes

OR

c) (i) Measurement of Dry mass and Wet mass

(ii) Using a spectrophotometer

(iii) Using a Slide counting Chamber

(iv) Using the Coulter chamber 

SECTION E

31. Several medically important protein pharmaceuticals have been produced using animal cell culture and recombinant DNA technology. Represent the animal cell line used for the production of the following proteins and their therapeutic use in a tabular form.

  • (a) Erythropoietin
  • (b) Factor VIII
  • (c) Follicle Stimulating Hormone (FSH)
  • (d) Interleukin 2 (IL 2)
  • (e) Monoclonal antibodies (mAbs)

Ans

OR

  • (a) Differentiate between-
  • (i) Defined and Serum-supplemented medium
  • (ii) Anchorage-dependent and Anchorage-independent cells
  • (b) Explain how pH is maintained in animal cell cultures. Mention two advantages of maintaining pH during such cultures.

Ans: (a) (i) A defined medium has known chemicals, of fixed composition and can support the growth of selected cells. Serum is an essential component of animal cell culture media and is a source of growth factors and hormones.

(ii) Anchorage-dependent cells grow as adherent cells, whereas anchorage-independent cells grow as suspension cultures.

(b) The most common buffering system used to maintain pH in animal cell Culture is the Bicarbonate-CO2system.Carbon dioxide from cells or the atmosphere interacts with water and leads to a drop in pH.

H2O + CO2《—-》H2CO3 《—–》( H+) + HCO3-1

An increase in Bicarbonate concentration neutralises the effect of increased Carbon dioxide according to the following equation:

NaHCO3 —> Na++ HCO3-1

The increased HCO3- ions derive the above equation to its left until equilibrium is reached at pH 7.4

Advantages :

i) pH is important to maintain in balance/ enzyme functions/ binding of hormones/growth factors to cell surface receptors/Ion balance (Any two)

32. a) Dr. Sharma discovered the first restriction enzyme ever from a bacterium called Thermus aquaticus, strain DR 15. Name the enzyme.

b) Design two primers (5 nucleotides long each) for the given sequence: 5‟GATTCATTGCGCGCATTACTCGCATT3‟

c) Recognition sites are generally palindromic in nature. Does it point towards the structure of restriction enzymes being that of a homodimer or heterodimer? Give a reason for your answer.

d) A bacteriophage is known to infect E. coli with pili. How can it be modified to serve as a suitable vector? 

Ans: (a) TaqDI

(b) 5′ AATGC 3′ and 5′ GATTC 3′

(c) Palindromic means the DNA sequence reads the same when read from 5′ to 3′. The restriction enzyme is a homodimer. As it cuts both strands of DNA simultaneously in the 5′ to 3′ direction.

(d) Foreign DNA can be inserted into the bacteriophage’s single-stranded, circular DNA of 6407 bp without disrupting any of the essential genes M13 is a filamentous phage which infects E. coli, having a pilus (protrusion) which is selectively present in cells containing an F plasmid (called F+ cells).

OR

a) Schematically explain the formation of a recombinant plasmid. (2)

b) Selection is an important step in genetic engineering. You are given ampicillin and tetracycline antibiotics. Using these antibiotics, which selection technique could be used to differentiate between recombinant and non-recombinant cells? (3)

Ans: a)

b) Replica plating.

  • Host cells are first plated (master plate) on solid media with the desired antibiotic overnight.
  • Velvet paper is aligned, pressed on the master plate.
  • With the same alignment, it is pressed onto the replica plate.
  • Keep it overnight,t ransformed colonies will not grow in the replica plate
  • Score off the colonies having inserts, from the master plate, by comparing the two plates.

33 (a) A group of students are trying to isolate recombinant insulin. After processing the fermentation broth, they observed no yield. What could be the most likely reason for this?

(b) A recently discovered microbial strain gives us the desired metabolite in nanomolar concentration. Suggest two ways of improving the production of the desired metabolite.

(c) Pichia pastoris has many advantages as an eukaryotic expression host. Justify giving two reasons.

Ans: (a) Recombinant insulin is an intracellular protein, so we need to process the cell mass and not the fermentation broth.

(b) Strain improvement is done to maximise metabolite production by:

  • i) Mutant selection: There are two methods – Physical method & Chemical Method
  • ii) Genetic engineering

(c) i) It has strong inducible promoters

ii) Capable of making post-translational modifications similar to those performed by human cells

iii) Downstream processing is simpler as Pichia does not secrete its own proteins into the fermentation medium.

OR

a) A professor told her students to ready a bacterial culture in 12 hours sharp. Suggest to her students two ways to enhance the growth of bacterial cells in the lab so that they are able to fulfil the requirement.

b) Write any two commercial significances of microbial cell culture.

c) There are many ways of measuring microbial growth. Which technique is considered the best and why?

Ans: a) Baffle flask: One of the simplest ways is to produce a V-shaped notch or indentation in the sides of the flask. Such flasks are called baffle flasks. This improves the growth of the microbes by improving the efficiency of oxygen transfer due to increased turbulence of the agitated culture medium.

Shakers: Continuous agitation of the culture medium also greatly improves the efficiency of the oxygen transfer, and this improves the growth of the microbes. In the laboratory, this is done by the use of shakers. Shakers may be end-to-end type or rotatory type. These may be designed for use at the ambient temperature or in a controlled temperature environment (incubator shaker).

b)

  • 1. Production of whole microbial cells (for food, vaccines)
  • 2. Production of primary metabolites (acids, alcohol)
  • 3. Production of secondary metabolites (antibiotics)
  • 4. Biotransformation reactions (enzymatic, steroid)
  • 5. Exploitation of metabolism (microbial leaching, biodegradable waste treatment)
  • 6. Synthesis of recombinant proteins (therapeutic proteins), Bioremediation/fermented food items/ recombinant proteins (Any two )

c) Viable Plate Count is the best method since it does not count dead microbial cells.

Additional Study Materials

Bio Smart Notes

Share
Published by
Bio Smart Notes

Recent Posts

Chapter 26. Environmental Degradation and Disaster Management Textbook Solutions

NIOS Social Science Class 10 Chapter 26 Solutions INTEXT QUESTIONS 26.1 1. Put the following…

21 hours ago

Tourism Chapter 18 – Communication and Personality Development

NIOS Class 12 Tourism Chapter 18 Solutions INTEXT QUESTIONS 18.1 1. Explain the importance of…

2 days ago

Chapter 25. Socio-economic Development and Empowerment of Disadvantaged Groups Textbook Solutions

NIOS Social Science Class 10 Chapter 25 Solutions INTEXT QUESTIONS 25.1 1. Why do GDP…

3 days ago

Tourism Chapter 17 – Human Resource Management-II

NIOS Class 12 Tourism Chapter 17 Solutions INTEXT QUESTIONS 17.1 1. What is training? What…

4 days ago

Chapter 24. National Integration and Secularism Textbook Solutions

NIOS Social Science Class 10 Chapter 24 Solutions INTEXT QUESTIONS 24.1 1. Fill in the…

5 days ago

Tourism Chapter 16 – Human Resource Management-I

NIOS Class 12 Tourism Chapter 16 Solutions INTEXT QUESTIONS 16.1 1. What do you understand…

6 days ago

This website uses cookies.